Nuclear Magnetic Resonance Studies of Platinum Anti-tumour and Related Complexes PDF Download
Are you looking for read ebook online? Search for your book and save it on your Kindle device, PC, phones or tablets. Download Nuclear Magnetic Resonance Studies of Platinum Anti-tumour and Related Complexes PDF full book. Access full book title Nuclear Magnetic Resonance Studies of Platinum Anti-tumour and Related Complexes by Ismail Mehmet Ismail. Download full books in PDF and EPUB format.
Author: Ismail Mehmet Ismail
Publisher:
ISBN:
Category :
Languages : en
Pages : 678
Get Book Here
Book Description
Author: Ismail Mehmet Ismail
Publisher:
ISBN:
Category :
Languages : en
Pages : 678
Get Book Here
Book Description
Author:
Publisher:
ISBN:
Category :
Languages : en
Pages : 586
Get Book Here
Book Description
Author: Donald S. Thomas
Publisher:
ISBN:
Category : Cancer
Languages : en
Pages : 202
Get Book Here
Book Description
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5;N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5o-d(TCTCCTATTCGCTTATCTCTC)-3o·5o- d(GAGAGATAAGCGAATAGGAGA)-3o (VB12), 5o-d(TCTCCTTCTTGTTCTTCCTCC)- 3o·5o-d(GGATTAAGAACAAGAAGGAGA)-3o (VB14) and 5o- d(CTCTCTCTATTGTTATCTCTTCT)-3o·5o-d(AGAAGAGATAACTATAGAGAGAG)-3o (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3o→3o and 5o→5o directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5o→5o direction.
Author: Danny Richard Bedgood
Publisher:
ISBN:
Category : Nuclear magnetic resonance
Languages : en
Pages : 328
Get Book Here
Book Description
Author: Gregory MacNeil
Publisher:
ISBN:
Category :
Languages : en
Pages : 0
Get Book Here
Book Description
Since the discovery of cisplatin, metal complexes continue to gain interest as anticancer agents. Though a breadth of research has been conducted in this field, many pitfalls and questions remain, such as off-target activity and how exactly metal complexes exhibit their activity. In the search for novel complexes that address these issues, ruthenium and copper have become leading choices. Though a vast array of complexes employing these metals have been reported, their clinical development has often been hindered by low activity and a lack in understanding of their mechanism of action. The work in this thesis looks to address these issues in two ways: (i) by developing novel complexes and methods to breath new life into well-studied metal compounds and (ii) employ magnetic resonance spectroscopies to examine their behaviour in relevant biological environments. Chapter 2 discusses the synthesis of a novel Ru(II)-arene complex appended with a selective estrogen receptor modifier to target breast cancer. These novel complexes were subjected to several different cell assays, including the National Cancer Institute NCI-60 screen, which showed increased activity over the inactive parent ruthenium scaffolds. Chapter 3 presents 19F magnetic resonance imaging methods to develop the theranostic applications of a CF3-appended Keppler-type Ru(III) complex. It is shown that these methods can be used to spatially resolve redox and speciation events in tumour tissues, which is important to understanding their mechanism of action. Chapter 4 presents a robust method to encapsulate these CF3 appended Ru(III) anticancer complexes in polymer nanoparticles to increase their aqueous stability. Cell studies revealed an over 10-fold increase in anticancer activity over the free complexes. Chapter 5 presents and in-depth magnetic resonance study of the aqueous solution behaviour of the copper anticancer complex CasIII-ia. EPR and NMR studies were used to characterize Cu species following dissolution in complex solutions containing HSA, and in the presence of whole cells. Finally, Chapter 6 presents a novel Ru(II)-Ru(III) complex combing the unique biological activities of an organometallic Ru(II) RAPTA-type scaffold and a Ru(III) Keppler-type coordination complex. Cytotoxicity studies of the new dinuclear complex show increased activity relative to mononuclear parent compounds.
Author: Shahid Ul-Islam
Publisher: John Wiley & Sons
ISBN: 1119640423
Category : Science
Languages : en
Pages : 432
Get Book Here
Book Description
This book is organized into 12 important chapters that focus on the progress made by metal-based drugs as anticancer, antibacterial, antiviral, anti-inflammatory, and anti-neurodegenerative agents, as well as highlights the application areas of newly discovered metallodrugs. It can prove beneficial for researchers, investigators and scientists whose work involves inorganic and coordination chemistry, medical science, pharmacy, biotechnology and biomedical engineering.
Author: Lloyd R. Kelland
Publisher: Springer Science & Business Media
ISBN:
Category : Medical
Languages : en
Pages : 370
Get Book Here
Book Description
Leading international experts comprehensively review all aspects of platinum anticancer drugs and their current use in treatment, as well as examining their future therapeutic prospects. Writing from a variety of disciplines, these authorities discuss the chemistry of cisplatin in aqueous solution, the molecular interaction of platinum drugs with DNA, and such exciting new areas as DNA mismatch repair and replicative bypass, apoptosis, and the transport of platinum drugs into tumor cells. The emergent platinum drugs of the future-orally active agents, the sterically hindered ZD0473, and the polynuclear charged platinum BBR3464-are also fully considered. Timely and interdisciplinary, Platinum-Based Drugs in Cancer Therapy offers cancer therapeutics specialists an illuminating survey of every aspect of platinum drugs from mechanisms of action to toxicology, tumor resistance, and new analogs.
Author: Robert C. Bast, Jr.
Publisher: John Wiley & Sons
ISBN: 111900084X
Category : Medical
Languages : en
Pages : 2004
Get Book Here
Book Description
Holland-Frei Cancer Medicine, Ninth Edition, offers a balanced view of the most current knowledge of cancer science and clinical oncology practice. This all-new edition is the consummate reference source for medical oncologists, radiation oncologists, internists, surgical oncologists, and others who treat cancer patients. A translational perspective throughout, integrating cancer biology with cancer management providing an in depth understanding of the disease An emphasis on multidisciplinary, research-driven patient care to improve outcomes and optimal use of all appropriate therapies Cutting-edge coverage of personalized cancer care, including molecular diagnostics and therapeutics Concise, readable, clinically relevant text with algorithms, guidelines and insight into the use of both conventional and novel drugs Includes free access to the Wiley Digital Edition providing search across the book, the full reference list with web links, illustrations and photographs, and post-publication updates
Author: G A Webb
Publisher: Royal Society of Chemistry
ISBN: 1847553877
Category : Science
Languages : en
Pages : 517
Get Book Here
Book Description
As a spectroscopic method, Nuclear Magnetic Resonance (NMR) has seen spectacular growth over the past two decades, both as a technique and in its applications. Today the applications of NMR span a wide range of scientific disciplines, from physics to biology to medicine. Each volume of Nuclear Magnetic Resonance comprises a combination of annual and biennial reports which together provide comprehensive of the literature on this topic. This Specialist Periodical Report reflects the growing volume of published work involving NMR techniques and applications, in particular NMR of natural macromolecules which is covered in two reports: "NMR of Proteins and Acids" and "NMR of Carbohydrates, Lipids and Membranes". For those wanting to become rapidly acquainted with specific areas of NMR, this title provides unrivalled scope of coverage. Seasoned practitioners of NMR will find this an in valuable source of current methods and applications. Specialist Periodical Reports provide systematic and detailed review coverage in major areas of chemical research. Compiled by teams of leading authorities in the relevant subject areas, the series creates a unique service for the active research chemist, with regular, in-depth accounts of progress in particular fields of chemistry. Subject coverage within different volumes of a given title is similar and publication is on an annual or biennial basis.
Author: Kenneth Kam-Wing Lo
Publisher: Academic Press
ISBN: 012803887X
Category : Science
Languages : en
Pages : 408
Get Book Here
Book Description
Inorganic and Organometallic Transition Metal Complexes with Biological Molecules and Living Cells provides a complete overview of this important research area that is perfect for both newcomers and expert researchers in the field. Through concise chapters written and edited by esteemed experts, this book brings together a comprehensive treatment of the area previously only available through scattered, lengthy review articles in the literature. Advanced topics of research are covered, with particular focus on recent advances in the biological applications of transition metal complexes, including inorganic medicine, enzyme inhibitors, antiparasital agents, and biological imaging reagents. - Geared toward researchers and students who seek an introductory overview of the field, as well as researchers working in advanced areas - Focuses on the interactions of inorganic and organometallic transition metal complexes with biological molecules and live cells - Foscuses on the fundamentals and their potential therapeutic and diagnostic applications - Covers recent biological applications of transition metal complexes, such as anticancer drugs, enzyme inhibitors, bioconjugation agents, chemical biology tools, and bioimaging reagents
