Multinuclear Platinum Anticancer Therapeutics PDF Download
Are you looking for read ebook online? Search for your book and save it on your Kindle device, PC, phones or tablets. Download Multinuclear Platinum Anticancer Therapeutics PDF full book. Access full book title Multinuclear Platinum Anticancer Therapeutics by Rasha A. Ruhayel. Download full books in PDF and EPUB format.
Author: Rasha A. Ruhayel
Publisher:
ISBN:
Category : Antineoplastic agents
Languages : en
Pages :
Get Book Here
Book Description
In the 1980's, Nicholas Farrell developed a range of structurally distinct multinuclear Pt complexes that form long-range interstrand crosslinks (IXLs) in DNA. The dinuclear complex [{trans-PtCl2(NH3)}2-æ-(H2N(CH2)6NH2)]2+ (1,1/t,t) was the first of this series to show promising results, however, it was the trinuclear complex [{trans-PtCl2(NH3)}2-æ-trans-Pt(NH3)2(H2N(CH2)6NH2)2]4+ (1,0,1/t,t,t or BBR3464) that was chosen for clinical trials based on significantly increased cytotoxicity compared to 1,1/t,t and cisplatin. Molecular biology experiments have shown that 1,1/t,t exclusively forms IXLs in DNA in the 5'{602} 5' direction, whilst 1,0,1/t,t,t can form IXLs in both the 5'{602}5' and 3'{602}3' directions. Previously, 2D [1H,15N] HSQC NMR has been used to study the formation of 5' 5' 1,4 GG IXLs. The formation of 3' 3' 1,4 GG IXLs have been studied as part of this thesis. More recently, Pt complexes such as [{trans PtCl2(NH3)}2{H2N(CH2)6(NH2(CH2)2NH2)(CH2)6NH2}]4+ (1,1/t,t 6,2,6) and [{trans PtCl2(NH3)}2{H2N(CH2)6(NH2)(CH2)6NH2}]3+ (1,1/t,t 6,6), where the charged central Pt moiety of 1,0,1/t,t,t is replaced by a polyamine linker, have been developed in the Farrell group and show increased potency compared to 1,0,1/t,t,t. The complex 1,1/t,t 6,2,6 is a lead candidate currently undergoing Phase I clinical trials. Prior to the work presented in this thesis, little was known about the aquation chemistry or kinetics of DNA binding of these novel complexes. Reported in Chapter 3 is the study of the formation of 3' 3' 1,4 GG IXLs by both 1,0,1/t,t,t and 1,1/t,t in the duplex 5' {d(TATACATGTATA)2} (33 14XL) (pH 5.4, 298K). A combination of 1D 1H and 2D [1H, 15N] HSQC NMR experiments was used to directly compare the results with the stepwise formation of the 5' 5' 1,4 GG IXL with the previously studied duplex, 5' {d(ATATGTACATAT)2} (55 14XL), under the same conditions. Preassociation as well as aquation were similar, however, differences were observed at the monofunctional binding step with evidence for numerous monofunctional adducts. Both reactions did not yield a single 3' 3' 1,4 GG IXL, rather several adducts that could not be characterised. Molecular dynamics simulations of the 3' 3' 1,4 GG IXLs showed highly distorted lesions that may have implication in cellular repair processes.
Author: Rasha A. Ruhayel
Publisher:
ISBN:
Category : Antineoplastic agents
Languages : en
Pages :
Get Book Here
Book Description
In the 1980's, Nicholas Farrell developed a range of structurally distinct multinuclear Pt complexes that form long-range interstrand crosslinks (IXLs) in DNA. The dinuclear complex [{trans-PtCl2(NH3)}2-æ-(H2N(CH2)6NH2)]2+ (1,1/t,t) was the first of this series to show promising results, however, it was the trinuclear complex [{trans-PtCl2(NH3)}2-æ-trans-Pt(NH3)2(H2N(CH2)6NH2)2]4+ (1,0,1/t,t,t or BBR3464) that was chosen for clinical trials based on significantly increased cytotoxicity compared to 1,1/t,t and cisplatin. Molecular biology experiments have shown that 1,1/t,t exclusively forms IXLs in DNA in the 5'{602} 5' direction, whilst 1,0,1/t,t,t can form IXLs in both the 5'{602}5' and 3'{602}3' directions. Previously, 2D [1H,15N] HSQC NMR has been used to study the formation of 5' 5' 1,4 GG IXLs. The formation of 3' 3' 1,4 GG IXLs have been studied as part of this thesis. More recently, Pt complexes such as [{trans PtCl2(NH3)}2{H2N(CH2)6(NH2(CH2)2NH2)(CH2)6NH2}]4+ (1,1/t,t 6,2,6) and [{trans PtCl2(NH3)}2{H2N(CH2)6(NH2)(CH2)6NH2}]3+ (1,1/t,t 6,6), where the charged central Pt moiety of 1,0,1/t,t,t is replaced by a polyamine linker, have been developed in the Farrell group and show increased potency compared to 1,0,1/t,t,t. The complex 1,1/t,t 6,2,6 is a lead candidate currently undergoing Phase I clinical trials. Prior to the work presented in this thesis, little was known about the aquation chemistry or kinetics of DNA binding of these novel complexes. Reported in Chapter 3 is the study of the formation of 3' 3' 1,4 GG IXLs by both 1,0,1/t,t,t and 1,1/t,t in the duplex 5' {d(TATACATGTATA)2} (33 14XL) (pH 5.4, 298K). A combination of 1D 1H and 2D [1H, 15N] HSQC NMR experiments was used to directly compare the results with the stepwise formation of the 5' 5' 1,4 GG IXL with the previously studied duplex, 5' {d(ATATGTACATAT)2} (55 14XL), under the same conditions. Preassociation as well as aquation were similar, however, differences were observed at the monofunctional binding step with evidence for numerous monofunctional adducts. Both reactions did not yield a single 3' 3' 1,4 GG IXL, rather several adducts that could not be characterised. Molecular dynamics simulations of the 3' 3' 1,4 GG IXLs showed highly distorted lesions that may have implication in cellular repair processes.
Author: Lloyd R. Kelland
Publisher: Springer Science & Business Media
ISBN: 1592590128
Category : Medical
Languages : en
Pages : 340
Get Book Here
Book Description
Leading international experts comprehensively review all aspects of platinum anticancer drugs and their current use in treatment, as well as examining their future therapeutic prospects. Writing from a variety of disciplines, these authorities discuss the chemistry of cisplatin in aqueous solution, the molecular interaction of platinum drugs with DNA, and such exciting new areas as DNA mismatch repair and replicative bypass, apoptosis, and the transport of platinum drugs into tumor cells. The emergent platinum drugs of the future-orally active agents, the sterically hindered ZD0473, and the polynuclear charged platinum BBR3464-are also fully considered. Timely and interdisciplinary, Platinum-Based Drugs in Cancer Therapy offers cancer therapeutics specialists an illuminating survey of every aspect of platinum drugs from mechanisms of action to toxicology, tumor resistance, and new analogs.
Author: Shiju C
Publisher: LAP Lambert Academic Publishing
ISBN: 9783846535189
Category :
Languages : en
Pages : 136
Get Book Here
Book Description
Some of the platinum complexes such as Cisplatin, carboplatin, and oxaliplatin are the FDA-approved members of the platinum anticancer drug family. Cisplatin, as one of the leading metal-based drugs, is widely used in the treatment of cancer. Significant side effects and drug resistance, however, have limited its clinical applications. These compounds induce apoptosis in tumor cells by binding to nuclear DNA, forming a variety of structural adducts and triggering cellular responses. Advances in biocoordination chemistry are crucial for improving the design of compounds to reduce toxic side effects and understand their mechanisms of action. In this report we present the development of platinum complexes such as platinum(II)-amine complexes, platinum(IV)-amine complexes, multi nuclear platinum complexes and some other platinum complexes as anti-cancer agents, with the purpose of providing an insight into the benefits of, and reasons for, their success.
Author: Daniel Yuan Qiang Wong
Publisher: Springer
ISBN: 9811085943
Category : Science
Languages : en
Pages : 169
Get Book Here
Book Description
This thesis describes the authors’ pioneering efforts in the conceptualization and implementation of combined platinum-based immuno-chemotherapeutics, which represent a significant paradigm shift from the conventional approach of directly targeting cancer. The work described has opened up a rich and largely unexplored area for platinum-based drug design, and ultimately paves the way for superior immuno-chemotherapeutics with better clinical outcome for patients. Historically, the contribution of the immune system to chemotherapy outcomes has been neglected, as anticancer drugs were believed to be immunosuppressive. However, this has been challenged by contemporary evidence suggesting that many chemotherapeutics, including platinum-based agents, stimulate the innate and/or adaptive immune system and that these “secret allies” contribute tangibly to clinical outcomes. A multi-pronged immuno-chemotherapeutic approach not only shrinks tumors, but more importantly, reactivate dormant immune responses to malignancies, eliminating residual cancer cells.
Author: Andrea Bonetti
Publisher: Springer Science & Business Media
ISBN: 1603274596
Category : Medical
Languages : en
Pages : 381
Get Book Here
Book Description
Cisplatin, the first member of the family of platinum-containing chemotherapeutic agents, was discovered by Barnett Rosenberg in 1965 and approved by the FDA for marketing in 1978. After 30 years of use in the clinic, cisplatin remains a central element of many treatment regimens. Cisplatin is still an irreplaceable component of a regimen that produces high cure rates in even advanced nonseminomatous germ-cell cancers, and is widely used in the treatment of ovarian cancers and other gynecologic cancers, head and neck, and numerous other tumor types. The development of carboplatin has reduced some of the adverse events associated with cisplatin treatment, and the introduction of the DACH platinum compound oxaliplatin has broadened the spectrum of activity of the platinums to include gastro-intestinal cancers, especially colorectal cancer. The clinical importance of this family of drugs continues to drive investigation into how these drugs work and how to improve their efficacy and reduce their toxicity. The papers in this volume were presented in Verona, Italy, during the tenth International Symposium on Platinum Coordination Compounds in Cancer Chemotherapy. The symposium was jointly organized by the Department of Oncology of the Mater Salutis Hospital – Azienda Sanitaria Locale 21 of the Veneto Region – and by the Department of Medicine and Public Health, Section of Pharmacology, the University of Verona. They reflect the vitality of this field and the increasing use of new molecular and cell biologic, genetic, and biochemical tools to identify approaches to further improve their use.
Author: Sotiris Missailidis
Publisher: John Wiley & Sons
ISBN: 0470697032
Category : Science
Languages : en
Pages : 424
Get Book Here
Book Description
Written by the winner of the 2008 Mike Price Fellowship "This volume provides a comprehensive overview of the wealth of information now available in this important and fast-moving subject." Anticancer Research, November - December 2008 This book provides a clear introduction to the area, with an overview of the various drug design and development approaches for cancer therapeutics and their progress in today’s multidisciplinary approach to cancer treatment. Clearly structured throughout, the book not only provides information on currently used molecular treatment approaches, but also describes the various agents that are currently at various stages of development and clinical trials, thus making them the drugs of tomorrow. The book goes on to present current therapeutic regimes including their indications and side effects, as well as their position in the international market in terms of sales and development costs. Furthermore, coverage of our advancement in the understanding of cancer biology and how this has driven the drug discovery process is clearly discussed. Modern drug discovery aspects, through genomic, proteomic and metabolomic approaches are referred to as well as combinatorial chemistry techniques and discovery of chemotherapeutic agents from plant extracts, re-use of old drugs and drugs from other indications, or de novo rational drug design. Including contributions from leading experts in the field, this book provides the reader with a complete overview of the various types of therapeutic agents, current and emerging, as well as other aspects associated with anticancer therapy, drug design, resistance and clinical trials in oncology.
Author: Astrid Sigel
Publisher: Walter de Gruyter GmbH & Co KG
ISBN: 311047073X
Category : Science
Languages : en
Pages : 588
Get Book Here
Book Description
Volume 18, entitled Metallo-Drugs: Development and Action of Anticancer Agents of the series Metal Ions in Life Sciences centers on biological, medicinal inorganic chemistry. The serendipitous discovery of the antitumor activity of cis-diamminodichloroplatinum(II) (cisplatin) by Barnett Rosenberg in the 1960s is a landmark in metallodrug-based chemotherapy. The success of cisplatin in the clinic, followed by oxaliplatin and carboplatin, along with their drawbacks relating mainly to resistance development and severe toxicity, initiated research on polynuclear platinum complexes and on Pt(IV) complexes as prodrugs. Furthermore, the indicated shortcomings led to the exploration of other transition and main group metal ions, among them Ru(II/III), Au(I/III), Ti(IV), V(IV/V), and Ga(III) including also the essential metal ions Fe(II/III), Cu(I/II), and Zn(II). Ionic as well as covalent and non-covalent interactions between structurally very different complexes and biomolecules like nucleic acids, proteins, and carbohydrates are studied and discussed with regard to their possible anticancer actions. Hence, MILS-18 summarizes the research at the forefront of medicinal inorganic chemistry, including studies on the next-generation, tailor-made anticancer drugs. All this and more is treated in an authoritative and timely manner in the 17 stimulating chapters of this book, written by 39 internationally recognized experts from 10 nations (from the US via Europe to China and Australia). The impact of this vibrant research area is manifested by more than 2700 references, nearly 150 illustrations (more than half in color) and several comprehensive tables. Metallo-Drugs: Development and Action of Anticancer Agents is an essential resource for scientists working in the wide range from enzymology, material sciences, analytical, organic, and inorganic biochemistry all the way through to medicine including the clinic ... not forgetting that it also provides excellent information for teaching.
Author: Donald S. Thomas
Publisher:
ISBN:
Category : Cancer
Languages : en
Pages : 202
Get Book Here
Book Description
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5;N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5o-d(TCTCCTATTCGCTTATCTCTC)-3o·5o- d(GAGAGATAAGCGAATAGGAGA)-3o (VB12), 5o-d(TCTCCTTCTTGTTCTTCCTCC)- 3o·5o-d(GGATTAAGAACAAGAAGGAGA)-3o (VB14) and 5o- d(CTCTCTCTATTGTTATCTCTTCT)-3o·5o-d(AGAAGAGATAACTATAGAGAGAG)-3o (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3o→3o and 5o→5o directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5o→5o direction.
Author: Justin Jeff Wilson
Publisher:
ISBN:
Category :
Languages : en
Pages : 345
Get Book Here
Book Description
(cont'd) Chapter 6. Synthesis, Characterization, and Cytotoxicity of Platinum(IV) Dicarbamate Complexes The reaction of cis,cis,trans-[Pt(NH3)2Cl2(OH)2] with alkyl and aryl isocyanates (RNCO) in DMF afforded dicarbamate complexes of the general formula cis,cis,trans- [Pt(NH 3)2Cl 2(O 2CNHR)2]. The resulting complexes were fully characterized by X-ray crystallography, multinuclear NMR spectroscopy, and cyclic voltammetry. The anticancer activities of these complexes were assessed in human lung cancer (A549) and human lung fibroblast (MRC-5) cell lines. Although no clear structure-activity relationships could be delineated, the complexes exhibited activity on the same order of magnitude as that of the clinically established drug cisplatin. Therefore, the reaction of cis,cis,trans-[Pt(NH3)2Cl 2(OH)2] with isocyanates provides a powerful new synthetic pathway to functionalize platinum(IV) anticancer agents. Appendix A. Aqueous Electrochemistry of a Platinum(IV) Prodrug Electrochemical studies of cis,cis,trans-[Pt(NH3)2Cl2(OAc) 2] in aqueous media were carried out. Cyclic voltammetry in pH 7.4 phosphate-buffered saline with glassy carbon and Pt disk working electrodes gave substantially different peak potentials for the irreversible reduction feature. Under these conditions, the glassy carbon electrode was plated with platinum metal derived from the platinum(IV) complex, as determined by cyclic voltammetry and chronoamperometry experiments. The bulk electrolysis of cis,cis,trans-[Pt(NH3)2Cl2(OAc)2] in aqueous solution at a carbon felt working electrode was investigated by 1H NMR spectroscopy. These studies indicate ligand loss upon reduction from both axial and equatorial sites of the platinum(IV) complex. Appendix B. Targeting the Mitochondria with Platinum Anticancer Agents using Mitochondria-Penetrating Peptides Early results of a collaborative effort with the lab of Professor Shana 0. Kelley at the University of Toronto to deliver platinum anticancer agents to the mitochondria are presented. Succinylacetone (Hsuccac) was used as a leaving group ligand for a cis-diammineplatinum(II) complex. The complex [Pt(succac)(NH 3)2](NO3), which contains a terminal, uncoordinated carboxylic acid functional group, was prepared and fully characterized. This complex was conjugated to a mitochondria-penetrating peptide (MPP) using standard solid-phase coupling chemistry. The anticancer activity of the Pt-MPP construct was tested in both wild-type and cisplatin-resistant ovarian cancer cell lines, A2780 and A2780CP70. Although less potent than cisplatin, the construct is equally toxic to both cell lines, thereby indicating that targeting the mitochondria provides a viable strategy for circumventing resistance to platinum drugs. Appendix C. Synthesis and Characterization of Several Novel Platinum Complexes Throughout the course of this thesis work, several platinum complexes were synthesized and characterized, but ultimately not fully pursued as potential anticancer agents. These species include platinum compounds with dichloroacetate, 2,2'-bis(1- methylimidazolyl)phenylmethoxymethane (BIPhMe), nitrogen mustard-containing, and nitroimidazole-derivatized ligands. The syntheses and characterization of these compounds are reported. Crystal structures are described for several of them.
Author: Xinghao Wang
Publisher:
ISBN: 9781361318065
Category :
Languages : en
Pages :
Get Book Here
Book Description
This dissertation, "Platinum on the Road: the Activation and Transport of Novel Platinum Anticancer Drugs by the Extracellular Domain of Human Copper Transporter I (HCTR1)" by Xinghao, Wang, 王星昊, was obtained from The University of Hong Kong (Pokfulam, Hong Kong) and is being sold pursuant to Creative Commons: Attribution 3.0 Hong Kong License. The content of this dissertation has not been altered in any way. We have altered the formatting in order to facilitate the ease of printing and reading of the dissertation. All rights not granted by the above license are retained by the author. Abstract: Platinum-based anticancer drugs such as cisplatin, carboplatin and nedaplatin have been widely used in the chemotherapy of a variety of solid tumours for several decades. However, the development of both inherent and acquired resistance has greatly limited the efficacy of all of these drugs. Several mechanisms were proposed to explain the cellular resistance to these platinum drugs, including decreased drug accumulation. Previously, it was suggested that cisplatin enters cells via passive diffusion, followed by intracellular hydrolysis and activation prior to targeting DNA. However, recent in vivo and in vitro studies confirmed that transporters and carriers involved in copper homeostasis play important roles on the transport as well as cellular resistance to the platinum drugs. CTR1, a major plasma-membrane transporter involved in intracellular copper(I) homeostasis, was found to facilitate the uptake of several platinum drugs although the molecular mechanism remains unclear. The extracellular N-terminal domain of human CTR1 (hCTR1) with two methionine(Met)-rich and two histidine(His)-rich motifs has been proved to be essential for the uptake of both copper and platinum drugs by the transporter. In this thesis, the extracellular domain of hCTR1 (hCTR1_N, residues 1-55) was overexpressed and the role of the Met- and His-rich motifs on cisplatin binding was examined by either mutagenesis or chemical modification. Cisplatin was found to directly and rapidly bind to the Met residues of hCTR1_N by the formation of monofunctional cisplatin-thioether adducts. The kinetics of the binding process was found to correlate with the number of Met residues, indicating that all Met residues are exposed to solvents and capable for cisplatin binding. Such a non-sequence-specific binding may increase the likelihood of capturing the anticancer drug in extracellular fluid by the N-terminus of hCTR1. The effect of hCTR_N on the binding and activation of second-generation platinum anticancer drugs, e.g. carboplatin and nedaplatin, were subsequently investigated. hCTR1_N was found to significantly facilitate the activation of these platinum drugs by the formation of ring-opened monofunctional Pt-thioether species through Met residues. Although the activities of platinum drugs against hCTR1_N are significantly different, their monofunctional protein-bound species demonstrated great similarity in both structure and kinetic aspects, suggesting the uptake of these platinum drugs by hCTR1 might follow the same mechanism. The formation of active ring-opened species of carboplatin and nedaplatin by chloride/bicarbonate was observed, indicating these nucleophiles may play a critical role in the pre-activation of the drugs prior to their reaching cellular targets. Pt-thioether species were proposed as intermediates for the platination of other biomolecules. The monofunctional cisplatin adduct of hCTR1_N was proved to further transfer its active platinum species to either cysteine- or guaninecontaining biomolecules which mimic the C-ternimus of hCTR1 and DNA. Methionine
